1395588

Question: . PCR 1: GCTGGCTGACATTTTCGGTGCGAGTATCCGTACCAT TCAGAACTGGCAGGAACAGGGAATGCCCGTTCT . PCR 2: TTAGCTCT…


. PCR 1: GCTGGCTGACATTTTCGGTGCGAGTATCCGTACCAT TCAGAACTGGCAGGAACAGGGAATGCCCGTTCT . PCR 2: TTAGCTCTTCAGGCTTCTGAAGAAGCGTTTCAAGT ACTAATAAGCCGATAGATAGCCACGGACTTCGTAG . PCR 3: AACCGCTTCATACATCTCGTAGATTTCTCTGGCGAT TGAAGGGCTAAATTCTTCAACGCTAACT What fragment size would you get if you use PCR 1 and PCR 2 with the Lambda DNA template? What fragment size would you get if you use PCR 2 and PCR 3 with the Lambda DNA template? What fragment size would you get if you use PCR 1 and PCR 3 with the Lambda DNA template?
media%2Fbfd%2Fbfd14149-6a00-4879-88c0-9e

see more
Show transcribed image text

. PCR 1: GCTGGCTGACATTTTCGGTGCGAGTATCCGTACCAT TCAGAACTGGCAGGAACAGGGAATGCCCGTTCT . PCR 2: TTAGCTCTTCAGGCTTCTGAAGAAGCGTTTCAAGT ACTAATAAGCCGATAGATAGCCACGGACTTCGTAG . PCR 3: AACCGCTTCATACATCTCGTAGATTTCTCTGGCGAT TGAAGGGCTAAATTCTTCAACGCTAACT What fragment size would you get if you use PCR 1 and PCR 2 with the Lambda DNA template? What fragment size would you get if you use PCR 2 and PCR 3 with the Lambda DNA template? What fragment size would you get if you use PCR 1 and PCR 3 with the Lambda DNA template?

(Visited 1 times, 1 visits today)