1395587

Question: Lambda DNA sequence complete(1) Review View No SpacingHeading1Heading 2 Normal Title Subtitle GGG…


Lambda DNA sequence complete(1) Review View No SpacingHeading1Heading 2 Normal Title Subtitle GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCTTCG TCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGGC TTTTTGGCCTCTGTCGTTTCCTTTCTCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCAACAAAAAGCA GCTGGCTGACATTTTCGGTGCGAGTATCCGTACCATTCAGAACTGGCAGGAACAGGGAATGCCCGTTCTG CGAGGCGGTGGCAAGGGTAATGAGGTGCTTTATGACTCTGCCGCCGTCATAAAATGGTATGCCGAAAGGG ATGCTGAAATTGAGAACGAAAAGCTGCGCCGGGAGGTTGAAGAACTGCGGCAGGCCAGCGAGGCAGATCT CCAGCCAGGAACTATTGAGTACGAACGCCATCGACTTACGCGTGCGCAGGCCGACGCACAGGAACTGAAG AATGCCAGAGACTCCGCTGAAGTGGTGGAAACCGCATTCTGTACTTTCGTGCTGTCGCGGATCGCAGGTG AAATTGCCAGTATTCTCGACGGGCTCCCCCTGTCGGTGCAGCGGCGTTTTCCGGAACTGGAAAACCGACA TGTTGATTTCCTGAAACGGGATATCATCAAAGCCATGAACAAAGCAGCCGCGCTGGATGAACTGATACCG GGGTTGCTGAGTGAATATATCGAACAGTCAGGTTAACAGGCTGCGGCATTTTGTCCGCGCCGGGCTTCGC TCACTGTTCAGGCCGGAGCCACAGACCGCCGTTGAATGGGCGGATGCTAATTACTATCTCCCGAAAGAAT CCGCATACCAGGAAGGGCGCTGGGAAACACTGCCCTTTCAGCGGGCCATCATGAATGCGATGGGCAGCGA CTACATCCGTGAGGTGAATGTGGTGAAGTCTGCCCGTGTCGGTTATTCCAAAATGCTGCTGGGTGTTTAT GCCTACTTTATAGAGCATAAGCAGCGCAACACCCTTATCTGGTTGCCGACGGATGGTGATGCCGAGAACT TTATGAAAACCCACGTTGAGCCGACTATTCGTGATATTCCGTCGCTGCTGGCGCTGGCCCCGTGGTATGG CAAAAAGCACCGGGATAACACGCTCACCATGAAGCGTTTCACTAATGGGCGTGGCTTCTGGTGCCTGGGC GGTAAAGCGGCAAAAAACTACCGTGAAAAGTCGGTGGATGTGGCGGGTTATGATGAACTTGCTGCTTTT ATGATGATATTGAACAGG CTCCGACGTTCCTGGGTGACAAGCGTATTGAAGGCTCGGTCTGGCc AAAGTCCATCCGTGGCTCCACGCCAAAAGTGAGAGGCACCTGTCAGATTGAGCGTGCAGCCAGTGAATCC CCGCATTITATGCGTTTTCATGTTGCCTGCCCGCATTGCGGGGAGGAGCAGTATCTTAAATTTGGCGACA AAGAGACGCCGTTTGGCCTCAAATGGACGCCGGATGACCCCTCCAGCGTGTTTTATCTCTGCGAGCATAA
Lambda DNA sequence

Show transcribed image text

Lambda DNA sequence complete(1) Review View No SpacingHeading1Heading 2 Normal Title Subtitle GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCTTCG TCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGGC TTTTTGGCCTCTGTCGTTTCCTTTCTCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCAACAAAAAGCA GCTGGCTGACATTTTCGGTGCGAGTATCCGTACCATTCAGAACTGGCAGGAACAGGGAATGCCCGTTCTG CGAGGCGGTGGCAAGGGTAATGAGGTGCTTTATGACTCTGCCGCCGTCATAAAATGGTATGCCGAAAGGG ATGCTGAAATTGAGAACGAAAAGCTGCGCCGGGAGGTTGAAGAACTGCGGCAGGCCAGCGAGGCAGATCT CCAGCCAGGAACTATTGAGTACGAACGCCATCGACTTACGCGTGCGCAGGCCGACGCACAGGAACTGAAG AATGCCAGAGACTCCGCTGAAGTGGTGGAAACCGCATTCTGTACTTTCGTGCTGTCGCGGATCGCAGGTG AAATTGCCAGTATTCTCGACGGGCTCCCCCTGTCGGTGCAGCGGCGTTTTCCGGAACTGGAAAACCGACA TGTTGATTTCCTGAAACGGGATATCATCAAAGCCATGAACAAAGCAGCCGCGCTGGATGAACTGATACCG GGGTTGCTGAGTGAATATATCGAACAGTCAGGTTAACAGGCTGCGGCATTTTGTCCGCGCCGGGCTTCGC TCACTGTTCAGGCCGGAGCCACAGACCGCCGTTGAATGGGCGGATGCTAATTACTATCTCCCGAAAGAAT CCGCATACCAGGAAGGGCGCTGGGAAACACTGCCCTTTCAGCGGGCCATCATGAATGCGATGGGCAGCGA CTACATCCGTGAGGTGAATGTGGTGAAGTCTGCCCGTGTCGGTTATTCCAAAATGCTGCTGGGTGTTTAT GCCTACTTTATAGAGCATAAGCAGCGCAACACCCTTATCTGGTTGCCGACGGATGGTGATGCCGAGAACT TTATGAAAACCCACGTTGAGCCGACTATTCGTGATATTCCGTCGCTGCTGGCGCTGGCCCCGTGGTATGG CAAAAAGCACCGGGATAACACGCTCACCATGAAGCGTTTCACTAATGGGCGTGGCTTCTGGTGCCTGGGC GGTAAAGCGGCAAAAAACTACCGTGAAAAGTCGGTGGATGTGGCGGGTTATGATGAACTTGCTGCTTTT ATGATGATATTGAACAGG CTCCGACGTTCCTGGGTGACAAGCGTATTGAAGGCTCGGTCTGGCc AAAGTCCATCCGTGGCTCCACGCCAAAAGTGAGAGGCACCTGTCAGATTGAGCGTGCAGCCAGTGAATCC CCGCATTITATGCGTTTTCATGTTGCCTGCCCGCATTGCGGGGAGGAGCAGTATCTTAAATTTGGCGACA AAGAGACGCCGTTTGGCCTCAAATGGACGCCGGATGACCCCTCCAGCGTGTTTTATCTCTGCGAGCATAA

(Visited 1 times, 1 visits today)